Talo-bucle

Na Galipedia, a Wikipedia en galego.
Exemplo de estrutura talo-bucle nun ARN.

Un emparellamento de bases intramolecular con estrutura talo-bucle é un tipo de patrón estrutural que pode aparecer no ARN ou, máis raramente, en ADNs monocatenarios. Tamén se chama talo-lazo, bucle en forquita ou, simplemente, forquita (en inglés stem-loop, hairpin loop). Orixínase cando dúas rexións da mesma cadea, xeralmente de secuencia de nucleótidos complementaria se a lemos en sentidos opostos, emparéllanse base a base para formar unha dobre hélice (o talo) que acaba nun bucle de bases desemparelladas (o bucle ou lazo). A estrutura resultante é unha peza básica da estrutura secundaria de moitos ARNs. [1]

Un exemplo dunha secuencia de ARN 5'→3' que orixinaría unha estrutura en forquita ou talo-bucle é:

GCCGCGGGCCGAAAAAACCCCCCCGGCCCGCGGC

Nela as secuencias en letra grosa, que son complementarias, emparellaríanse formando o talo, e a secuencia central non complementaria formaría o bucle.

Formación e estabilidade[editar | editar a fonte]

A formación dunha estrutura talo-bucle depende da estabilidade das rexións en hélice e bucle resultantes. O primeiro prerrequisito é a presenza dunha secuencia que poida dobrarse sobre si mesma para formar unha dobre hélice con emparellamento de bases. A estabilidade desta hélice está determinada pola súa lonxitude, o número de desemparellamentos ou vultos que contén (un pequeno número é tolerable, especialmente nas hélices longas) e a composición en bases da rexión emparellada. Os emparellamentos entre a guanina e a citosina teñen tres enlaces de hidróxeno e son máis estables comparados cos emparellamentos adenina-uracilo, que só forman dous. No ARN, os emparellamentos guanina-uracilo forman dous enlaces de hidróxeno e son tamén comúns e favorables. As interaccións debidas á colocación das bases unha enriba da outra de modo que quedan alineados os orbitais pi dos aneis aromáticos das bases nunha orientación favorable, tamén promoven a formación da hélice.

A estabilidade do bucle tamén inflúe na formación da estrutura talo-bucle. Os posibles "bucles" que teñan menos de tres bases de longo son estericamente imposibles e non se poden formar. Os bucles grandes sen estrutura secundaria propia (como nos emparellamentos pseudonó) son tamén inestables. A lonxitude óptima do bucle adoita a ser de 4-8 bases. Un bucle común coa estrutura UUCG denomínase o "tetrabucle" e é especialmente estable debido ás interaccións dos compoñentes dos nucleótidos cando as bases están unha sobre a outra.

A presenza de sales, e en particular de ións divalentes como o magnesio (Mg2+) estabiliza estas estruturas; o aumento da temperatura provoca a súa desaparición. É posible predicir a estabilidade das estruturas en talo-bucle por medio de regras termodinámicas baseadas na análise empírica dun gran número de dúplex de ARN [2].

Exemplos[editar | editar a fonte]

Ribocima cabeza de martelo.
O ARNt presenta tres estruturas talo-bucle.

As estruturas talo-bucle aparecen no pre-microARN e no ARN transferente, que contén tres verdadeiras estruturas talo-bucle e un talo (brazo) adicional que forma o "talo" da súa forma característica de "folla de trevo". O anticodón que recoñece o codón durante o proceso de tradución está localizado nun dos bucles do ARNt. Dúas estruturas solapadas talo-bucle aparecen nos pseudonós do ARN, nas que o bucle dunha estrutura forma parte do segundo talo.

Moitos ribocimas tamén forman estruturas en talo-bucle. O ribocima cabeza de martelo que se autoprocesa contén tres estruturas talo-bucle que se unen nunha rexión central desemparellada onde está o sitio de corte. A estrutura secundaria básica do ribocima cabeza de martelo requírese para a súa actividade de auto-clivaxe.

A formación dunha estrutura talo-bucle no ARNm no sitio de unión ao ribosoma pode controlar a iniciación da tradución. [3][4]

As estruturas talo-bucle son tamén importantes nos procariotas durante a terminación da transcrición independente de rho. Fórmase un bucle en forquita nunha fibra de ARNm durante a transcrición, que causa que a ARN polimerase se disocie da fibra molde do ADN. Este proceso coñécese como terminación independente de rho ou terminación intrínseca, e as secuencias implicadas chámanse secuencias terminadoras.

Notas[editar | editar a fonte]

  1. Watson JD, Baker TA, Bell SP, Gann A, Levine M, Losick R. (2004). Molecular Biology of the Gene. 5th ed. Pearson Benjamin Cummings: CSHL Press. Ver especialmente o capítulo 6.
  2. Freier, S.M.; Kierzek, R.; Jaeger, J.A.; Sugimoto, N.; Caruthers, M.H.; Neilson, T.; Turner, D.H. (1986). "Improved free-energy parameters for predictions of RNA duplex stability.". Proc. Natl. Acad. Sci. USA 83: 9373-9377. PMID 2432595. PMID 2432595.
  3. Malys N, Nivinskas R (2009). "Non-canonical RNA arrangement in T4-even phages: accommodated ribosome binding site at the gene 26-25 intercistronic junction". Mol Microbiol 73 (6): 1115–1127. DOI:10.1111/j.1365-2958.2009.06840.x. PMID 19708923.
  4. Malys N, McCarthy JEG (2010). "Translation initiation: variations in the mechanism can be anticipated". Cellular and Molecular Life Sciences 68 (6): 991–1003. DOI:10.1007/s00018-010-0588-z. PMID 21076851.

Véxase tamén[editar | editar a fonte]

Outros artigos[editar | editar a fonte]