Diferenzas entre revisións de «Elemento Alu»

Saltar ata a navegación Saltar á procura
m
Arranxos varios, replaced: {{cite web → {{Cita web, {{cite journal → {{Cita publicación periódica (30)
m (Arranxos varios, replaced: {{cite web → {{Cita web, {{cite journal → {{Cita publicación periódica (30))
Un '''elemento ''Alu''''' é un curto tramo de [[ADN]] que foi caracterizado orixinalmente pola acción da [[endonuclease de restrición]] da [[bacteria]] ''[[Arthrobacter luteus]] (Alu)'', que se pode encontrar no [[xenoma humano]] e no doutros [[primates]].<ref name=pmid1052772>{{citeCita journalpublicación periódica |doi=10.1016/0092-8674(75)90184-1 |pmid=1052772 |title=Sequence organization of the human genome |journal=Cell |volume=6 |issue=3 |pages=345–58 |year=1975 |last1=Schmid |first1=Carl W |last2=Deininger |first2=Prescott L }}</ref> Os elementos ''Alu'' son os [[elemento transpoñible|elementos transpoñibles]] máis abondosos, pois comprenden aproximadamente un millón de copias espalladas polo xenoma humano.<ref name=pmid9694261>{{citeCita journalpublicación periódica |doi=10.1002/elps.1150190806 |pmid=9694261 |title=Effects of ''Alu'' insertions on gene function |journal=Electrophoresis |volume=19 |issue=8–9 |pages=1260–4 |year=1998 |last1=Szmulewicz |first1=Martin N |last2=Novick |first2=Gabriel E |last3=Herrera |first3=Rene J }}</ref> Os elementos ''Alu'' son tamén coñecidos como [[xene]]s egoístas ou parasitos, porque a súa única función é a súa autorreprodución.<ref name=pmid11263730>{{citeCita journalpublicación periódica |doi=10.1554/0014-3820(2001)055[0001:ptepda]2.0.co;2 |pmid=11263730 |title=Perspective: Transposable Elements, Parasitic Dna, and Genome Evolution |journal=Evolution |volume=55 |issue=1 |pages=1–24 |year=2001 |last1=Kidwell |first1=Margaret G |last2=Lisch |first2=Damon R }}</ref> Derivan dun pequeno [[ARN 7SL]] citoplasmático, un compoñente da [[partícula de recoñecemento do sinal]]. Os elementos ''Alu'' están moi [[conservación (xenética)|conservados]] nos [[xenoma]]s dos primates e orixináronse no xenoma dun antepasado dos [[Supraprimates]].<ref name=pmid17307271>{{citeCita journalpublicación periódica |doi=10.1016/j.tig.2007.02.002 |pmid=17307271 |title=Evolutionary history of 7SL RNA-derived SINEs in Supraprimates |journal=Trends in Genetics |volume=23 |issue=4 |pages=158–61 |year=2007 |last1=Kriegs |first1=Jan Ole |last2=Churakov |first2=Gennady |last3=Jurka |first3=Jerzy |last4=Brosius |first4=Jürgen |last5=Schmitz |first5=Jürgen }}</ref>
 
As insercións ''Alu'' foron implicadas en varias doenzas humanas hereditarias e en varias formas de cancro.<ref name=pmid11988762/><ref name=pmid22204421/>
== A familia Alu ==
 
A familia Alu é unha familia de elementos repetitivos dos xenomas de [[primates]], incluíndo o xenoma humano.<ref>{{CiteCita journalpublicación periódica|last=Arcot|first=Santosh S.|last2=Wang|first2=Zhenyuan|last3=Weber|first3=James L.|last4=Deininger|first4=Prescott L.|last5=Batzer|first5=Mark A.|date=September 1995|title=Alu Repeats: A Source for the Genesis of Primate Microsatellites|journal=Genomics|volume=29|issue=1|pages=136–144|doi=10.1006/geno.1995.1224|issn=0888-7543}}</ref> Os elementos ''Alu'' modernos teñen unhas 300 [[par de bases|pares de bases]] de lonxitude e, por tanto, son clasificados como [[SINE|elementos nucleares intercalados curtos]] (SINEs) dentro da clase dos elementos de ADN repetitivos. A estrutura típica é 5' - Parte A - A5TACA6 - Parte B - Cola poliA - 3', onde Parte A e Parte B son secuencias nucleotídicas similares. Dito con outras palabras, crese que os elementos ''Alu'' modernos xurdiron dunha fusión cabeza con cola de dous monómeros antigos fósiles (ou FAMs, do inglés ''fossil antique monomers'') distintos hai uns 100 millóns de anos, polo que a súa estrutura é dímero|dímera]] con dous monómeros distintos, aínda que similares (brazos esquerdo e dereito), unidos por un tramo ligador (''linker'') rico en [[adenina|A]].<ref name=pmid17020921>{{citeCita journalpublicación periódica |doi=10.1093/nar/gkl706 |pmid=17020921 |pmc=1636486 |title=Alu elements as regulators of gene expression |journal=Nucleic Acids Research |volume=34 |issue=19 |pages=5491–7 |year=2006 |last1=Häsler |first1=Julien |last2=Strub |first2=Katharina }}</ref> A lonxitude da [[cola poliA]] varía entre familias ''Alu''.
 
Hai aproximadamente un millón de elementos ''Alu'' espallados polo xenoma humano e estímase que un 10,7% do xenoma humano consta de secuencias ''Alu''. Porén, menos do 0,5% son [[polimorfismo (bioloxía)|polimórficos]] (é dicir, aparecen en máis dunha forma ou morfo).<ref name=pmid11560904>{{citeCita journalpublicación periódica |pmid=11560904 |pmc=1461783 |year=2001 |author1=Roy-Engel |first1=A. M |title=Alu insertion polymorphisms for the study of human genomic diversity |journal=Genetics |volume=159 |issue=1 |pages=279–90 |last2=Carroll |first2=M. L |last3=Vogel |first3=E |last4=Garber |first4=R. K |last5=Nguyen |first5=S. V |last6=Salem |first6=A. H |last7=Batzer |first7=M. A |last8=Deininger |first8=P. L }}</ref> In 1988, [[Jerzy Jurka]] e [[Temple Smith]] descubriron que os elementos ''Alu'' estaban divididos en dúas grandes subfamilias chamadas AluJ (nomeada coa inicial do nome de Jurka) e AluS (nomeada pola de Smith), e outras subfamilias Alu foron tamén descubertas independentemente por diversos grupos.<ref name=pmid3387438>{{citeCita journalpublicación periódica |doi=10.1073/pnas.85.13.4775 |pmid=3387438 |pmc=280518 |title=A fundamental division in the Alu family of repeated sequences |journal=Proceedings of the National Academy of Sciences |volume=85 |issue=13 |pages=4775–8 |year=1988 |last1=Jurka |first1=J |last2=Smith |first2=T |bibcode=1988PNAS...85.4775J }}</ref> Posteriormente, unha subfamilia de AluS, incluía elementos Alu activos aos que se denominou AluY. A liñaxe AluJ data de hai 65 millóns de anos é o máis antigo e menos activo no xenoma humano. A liñaxe máis recente AluS é de hai uns 30 millóns de anos e aínda contén algúns elementos activos. Finalmente, os elementos AluY son os máis novos dos tres e teñen a maior disposición a moverse ao longo do xenoma humano.<ref name=pmid18836035>{{citeCita journalpublicación periódica |doi=10.1101/gr.081737.108 |pmid=18836035 |pmc=2593586 |title=Active Alu retrotransposons in the human genome |journal=Genome Research |volume=18 |issue=12 |pages=1875–83 |year=2008 |last1=Bennett |first1=E. A |last2=Keller |first2=H |last3=Mills |first3=R. E |last4=Schmidt |first4=S |last5=Moran |first5=J. V |last6=Weichenrieder |first6=O |last7=Devine |first7=S. E }}</ref> O descubrimento de subfamilias ''Alu'' orixinou a hipótese dos xenes mestres/fonte, e proporcionou a ligazón definitiva entre elementos transposables (elementos activos) e ADN repetitivo intercalado (copias mutadas de elementos activos).<ref name=pmid1774786>{{citeCita journalpublicación periódica |doi=10.1007/bf02102862 |pmid=1774786 |title=Evolution of the master Alu gene(s) |journal=Journal of Molecular Evolution |volume=33 |issue=4 |pages=311–20 |year=1991 |last1=Richard Shen |first1=M |last2=Batzer |first2=Mark A |last3=Deininger |first3=Prescott L |bibcode=1991JMolE..33..311R }}</ref><ref>E. Andrew Bennett, Heiko Keller, Ryan E. Mills, Steffen Schmidt, John V. Moran, Oliver Weichenrieder, e Scott E. Devine. Active Alu retrotransposons in the human genome. Genome Research. 2008 Dec; 18(12): 1875–1883. doi: 10.1101/gr.081737.108. PMCID: PMC2593586. PMID 18836035. [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC259358]</ref>
 
== ARN 7SL ==
O extremo 5’ dos ''Alu'' deriva do ARN 7SL, unha secuencia transcrita por unha ARN polimerase III que codifica o elemento de ARN de SRP, unha abundante [[ribonucleoproteína]].<ref>Kriegs J et al. (April 2007). Evolutionary history of 7SL RNA-derived SINEs in Supraprimates. Trends Genet 23(4), 158-161.</ref>
 
A secuencia consenso dunha subfamilia principal de Alu contén un elemento de resposta ao ácido retinoico fncional. Os sitios hexámeros do elemento de resposta ao [[ácido retinoico]] funcional<ref name=pmid7667273>{{citeCita journalpublicación periódica |doi=10.1073/pnas.92.18.8229 |pmid=7667273 |pmc=41130 |title=The consensus sequence of a major Alu subfamily contains a functional retinoic acid response element |journal=Proceedings of the National Academy of Sciences |volume=92 |issue=18 |pages=8229–33 |year=1995 |last1=Vansant |first1=G |last2=Reynolds |first2=W. F |bibcode=1995PNAS...92.8229V }}</ref> aparecen a continuación en maiúsculas e solápanse co [[promotor (xenética)|promotor]] transcricional interno. Un exemplo dun monómero ''Alu'' humano, de 153 pares de bases, derivado do ARN 7SL é: GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCagctACTCGGGAGGCTGAGGCTGGAGGATCGCTTGAGTCCAGGAGT
TCTGGGCTGTAGTGCGCTATGCCGATCGGAATAGCCACTGCACTCCAGCCTGGGCAACATAGCGAGACCCCGTCTC.
 
A secuencia de recoñecemento da [[endonuclease]] ''[[Arthrobacter_luteusArthrobacter luteus|Alu I]]'' é 5' ag/ct 3'; é dicir, o [[enzima]] corta o segmento de ADN entre os residuos de [[guanina]] e [[citosina]] (en maiúsculas arriba). <ref>{{citeCita publicación journalperiódica | journal=Nature | date=1984 | volume=312 |issue=5990 | pages=171–2 | title=Alu sequences are processed 7SL RNA genes | author=Ullu E, Tschudi C | pmid= 6209580| doi=10.1038/312171a0 }}</ref>
 
== Elementos Alu ==
Os elementos ''Alu'' son responsables da regulación de xenes específicos de tecidos. Están tamén implicados na transcrición de xenes próximos e poden ás veces cambiar o modo en que se [[expresión xénica|expresa un xene]].<ref name=pmid8790336>{{citeCita journalpublicación periódica |pmid=8790336 |pmc=38434 |year=1996 |author1=Britten |first1=R. J |title=DNA sequence insertion and evolutionary variation in gene regulation |journal=Proceedings of the National Academy of Sciences of the United States of America |volume=93 |issue=18 |pages=9374–7 |doi=10.1073/pnas.93.18.9374|bibcode=1996PNAS...93.9374B }}</ref>
 
Os elementos ''Alu'' son [[retrotransposón]]s e parecen copias de ADN feitas a partir de ARNs transcritos pola [[ARN polimerase III]]. Os elementos ''Alu'' non codifican produtos proteicos. Son replicados como calquera outra [[secuencia de ADN]], pero depende de retrotransposóns [[LINE]] para a xeración de novos elementos.<ref name=pmid16344113>{{citeCita journalpublicación periódica |doi=10.1016/S0074-7696(05)47004-7 |pmid=16344113 |title=Short Retroposons in Eukaryotic Genomes |journal=International Review of Cytology |volume=247 |pages=165–221 |year=2005 |last1=Kramerov |first1=D |last2=Vassetzky |first2=N }}</ref>
 
A replicación e mobilización de elementos ''Alu'' empeza por interaccións coas [[partícula de recoñecemento do sinal|partículas de recoñecemento do sinal]] (SRPs), que axudan a que as proteínas recentemente traducidas alcanzan os seus destinos finais.<ref name=pmid11089964>{{citeCita journalpublicación periódica |doi=10.1038/35041507 |pmid=11089964 |title=Structure and assembly of the Alu domain of the mammalian signal recognition particle |journal=Nature |volume=408 |issue=6809 |pages=167–73 |year=2000 |last1=Weichenrieder |first1=Oliver |last2=Wild |first2=Klemens |last3=Strub |first3=Katharina |last4=Cusack |first4=Stephen |bibcode=2000Natur.408..167W }}</ref> O ARN ''Alu'' forma un complexo proteico específico cun heterodímero proteico que consta de SRP9 e SRP14.<ref name="pmid11089964"/> O SRP9/14 facilita a unión dos ''Alu'' aos [[ribosoma]]s que capturan as [[LINE1|proteínas L1]] nacentes. Así, un elemento ''Alu'' pode tomar o control da [[transcritase inversa]] da proteína L1, asegurando que as secuencias de ARN dos ''Alu'' son copiados no xenoma en vez do [[ARNm]] de L1.<ref name="pmid18836035"/>
 
Os elementos ''Alu'' en primates forman un rexistro fósil que é relativamente doado de descifrar porque os eventos de inserción de elementos ''Alu'' teñen unha sinatura características que é fácil de ler e queda gravada fielmente no xenoma de [[xeración]] en xeración. O estudo dos elementos ''AluY'' (os que evolucionaron máis recentemente) revelou detalles de ascendencia común porque os individuos só comparten unha determinada inserción de elemento ''Alu'' se teñen un antepasado común.{{citation needed|date=December 2017}} Isto débese a que a inserción dun elemento ''Alu'' ocorre só de 100 a 200 veces por millón de anos, e non se coñece ningún mecanismo para a súa [[deleción]]. Por tanto, os individuos cun elemento probablemente descenden dun antepasado que tiña un, e viceversa para aqueles sen el. En xenética, a presenza ou ausencia dun elemento ''Alu'' inserido recentemente pode ser unha boa propiedade a considerar cando se estuda a evolución humana.<ref name=Lacau>{{CiteCita journalpublicación periódica|last=Terreros|first=Maria C.|last2=Alfonso-Sanchez|first2=Miguel A.|last3=Novick|last4=Luis|last5=Lacau|last6=Lowery|last7=Regueiro|last8=Herrera|date=September 11, 2009|title=Insights on human evolution: an analysis of Alu insertion polymorphisms|journal=Journal of Human Genetics|volume=54|issue=10|pages=603–611|doi=10.1038/jhg.2009.86|pmid=19745832}}</ref><ref>Mark Stoneking, Jennifer J. Fontius, Stephanie L. Clifford, Himla Soodyall, Santosh S. Arcot, Nilmani Saha, Trefor Jenkins, Mohammad A. Tahir, Prescott L. Deininger, e Mark A. Batzer. Alu Insertion Polymorphisms and Human Evolution: Evidence for a Larger Population Size in Africa. Genome Research. 1997 Nov; 7(11): 1061–1071. PMCID: PMC310683. PMID 9371742. [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC310683/]</ref><ref>W. Scott Watkins, Alan R. Rogers, Christopher T. Ostler, Steve Wooding, Michael J. Bamshad, Anna-Marie E. Brassington, Marion L. Carroll, Son V. Nguyen, Jerilyn A. Walker, B.V. Ravi Prasad, P. Govinda Reddy, Pradipta K. Das, Mark A. Batzer, e Lynn B. Jorde. Genetic Variation Among World Populations: Inferences From 100 Alu Insertion Polymorphisms. Genome Res. 2003 Jul; 13(7): 1607–1618. doi: 10.1101/gr.894603. PMCID: PMC403734. PMID 12805277.</ref>
 
A maioría das insercións de elementos ''Alu'' humanos poden encontrarse nas posicións correspondentes nos xenomas doutros primates, pero unhas 7000 insercións de ''Alu'' son exclusivas dos humanos.<ref name=pmid16136131>{{citeCita journalpublicación periódica |doi=10.1038/nature04072 |pmid=16136131 |title=Initial sequence of the chimpanzee genome and comparison with the human genome |journal=Nature |volume=437 |issue=7055 |pages=69–87 |year=2005 |bibcode=2005Natur.437...69. |author1=Chimpanzee Sequencing Analysis Consortium }}</ref>
 
== Impacto dos Alu en humanos ==
 
Propúxose que os elementos ''Alu'' afectan á [[expresión xénica]] e conteñen rexións promotoras funcionais para receptores de hormonas esteroides.<ref name=pmid7667273/><ref name=pmid7559405>{{citeCita journalpublicación periódica |pmid=7559405 |year=1995 |author1=Norris |first1=J |title=Identification of a new subclass of Alu DNA repeats that can function as estrogen receptor-dependent transcriptional enhancers |journal=The Journal of Biological Chemistry |volume=270 |issue=39 |pages=22777–82 |last2=Fan |first2=D |last3=Aleman |first3=C |last4=Marks |first4=J. R |last5=Futreal |first5=P. A |last6=Wiseman |first6=R. W |last7=Iglehart |first7=J. D |last8=Deininger |first8=P. L |last9=McDonnell |first9=D. P |doi=10.1074/jbc.270.39.22777}}</ref> Debido ao abondoso contido de dinucleótidos [[sitio CpG|CpG]] atopado nos elementos ''Alu'', estas rexións serven como sitio de [[metilación]], contribuíndo ata co 30% dos sitios de metilación no xenoma humano.<ref name=pmid9753719>{{citeCita journalpublicación periódica |doi=10.1093/nar/26.20.4541 |pmid=9753719 |pmc=147893 |title=Does SINE evolution preclude Alu function? |journal=Nucleic Acids Research |volume=26 |issue=20 |pages=4541–50 |year=1998 |last1=Schmid |first1=C. W }}</ref> Porén, os elementos ''Alu'' son tamén unha fonte común de [[mutación]]s en humanos, e tales mutacións están a miúdo confinadas a rexións non codificantes dos [[pre-ARNm]] ([[intrón]]s), onde teñen pouco impacto discernible no individuo portador.<ref name=pmid11237011>{{citeCita journalpublicación periódica |doi=10.1038/35057062 |pmid=11237011 |title=Initial sequencing and analysis of the human genome |journal=Nature |volume=409 |issue=6822 |pages=860–921 |year=2001 |last1=Lander |first1=Eric S |last2=Linton |first2=Lauren M |last3=Birren |first3=Bruce |last4=Nusbaum |first4=Chad |last5=Zody |first5=Michael C |last6=Baldwin |first6=Jennifer |last7=Devon |first7=Keri |last8=Dewar |first8=Ken |last9=Doyle |first9=Michael |last10=Fitzhugh |first10=William |last11=Funke |first11=Roel |last12=Gage |first12=Diane |last13=Harris |first13=Katrina |last14=Heaford |first14=Andrew |last15=Howland |first15=John |last16=Kann |first16=Lisa |last17=Lehoczky |first17=Jessica |last18=Levine |first18=Rosie |last19=McEwan |first19=Paul |last20=McKernan |first20=Kevin |last21=Meldrim |first21=James |last22=Mesirov |first22=Jill P |last23=Miranda |first23=Cher |last24=Morris |first24=William |last25=Naylor |first25=Jerome |last26=Raymond |first26=Christina |last27=Rosetti |first27=Mark |last28=Santos |first28=Ralph |last29=Sheridan |first29=Andrew |last30=Sougnez |first30=Carrie |display-authors=29 |bibcode=2001Natur.409..860L }}</ref> As mutacións nos intróns (ou rexións non codificantes do ARN) teñen pouco ou ningún efecto sobre o [[fenotipo]] dun individuo se a porción codificada do xenoma do individuo non contén mutacións. As insercións Alu que poden ser prexudiciais para o corpo humano están inseridas en rexións codificantes ([[exón]]s) ou en ARNm despois do proceso de [[empalme de ARN|empalme]].<ref name=pmid10381326>{{citeCita journalpublicación periódica |doi=10.1006/mgme.1999.2864 |pmid=10381326 |title=Alu Repeats and Human Disease |journal=Molecular Genetics and Metabolism |volume=67 |issue=3 |pages=183–93 |year=1999 |last1=Deininger |first1=Prescott L |last2=Batzer |first2=Mark A }}</ref>
 
Porén, a variación xerada pode utilizarse en estudos do movemento e ascendencia común das poboaciósn humanas,<ref name=pmid11988762>{{citeCita journalpublicación periódica |doi=10.1038/nrg798 |pmid=11988762 |title=Alu Repeats and Human Genomic Diversity |journal=Nature Reviews Genetics |volume=3 |issue=5 |pages=370–9 |year=2002 |last1=Batzer |first1=Mark A |last2=Deininger |first2=Prescott L }}</ref> e o efecto mutaxénico dos ''Alu''<ref name=pmid21282640>{{citeCita journalpublicación periódica |doi=10.1073/pnas.1012834108 |pmid=21282640 |pmc=3041063 |title=Widespread establishment and regulatory impact of Alu exons in human genes |journal=Proceedings of the National Academy of Sciences |volume=108 |issue=7 |pages=2837–42 |year=2011 |last1=Shen |first1=S |last2=Lin |first2=L |last3=Cai |first3=J. J |last4=Jiang |first4=P |last5=Kenkel |first5=E. J |last6=Stroik |first6=M. R |last7=Sato |first7=S |last8=Davidson |first8=B. L |last9=Xing |first9=Y |bibcode=2011PNAS..108.2837S }}</ref> e retrotransposóns en xeral xogou un papel significativo na evolución recente do xenoma humano.<ref name=pmid19763152>{{citeCita journalpublicación periódica |doi=10.1038/nrg2640 |pmid=19763152 |pmc=2884099 |title=The impact of retrotransposons on human genome evolution |journal=Nature Reviews Genetics |volume=10 |issue=10 |pages=691–703 |year=2009 |last1=Cordaux |first1=Richard |last2=Batzer |first2=Mark A }}</ref> Hai tamén varios casos nos que as insercións ou delecións ''Alu'' están asociadas con efectos específicos nos humanos:
 
=== Asociacións con enfermidades humanas ===
 
As insercións ''Alu'' son ás veces disruptivas e poden causar trastornos herdados. Porén, a maioría das variacións ''Alu'' actúan como marcadores que segregan coa enfermidade, polo que a presenza dun determinado [[alelo]] ''Alu'' non significa que o portador vaia ter necesariamente a doenza. O primeiro informe de [[recombinación xenética|recombinación]] mediada por ''Alu'' causante dunha predisposición herdada prevalente ao cancro fíxose nun artigo de 1995 sobre o ''cancro colorrectal non poliposo hereditario''.<ref name=pmid7584997>{{citeCita journalpublicación periódica |doi=10.1038/nm1195-1203 |pmid=7584997 |title=Founding mutations and Alu-mediated recombination in hereditary colon cancer |journal=Nature Medicine |volume=1 |issue=11 |pages=1203–6 |year=1995 |last1=Nyström-Lahti |first1=Minna |last2=Kristo |first2=Paula |last3=Nicolaides |first3=Nicholas C |last4=Chang |first4=Sheng-Yung |last5=Aaltonen |first5=Lauri A |last6=Moisio |first6=Anu-Liisa |last7=Järvinen |first7=Heikki J |last8=Mecklin |first8=Jukka-Pekka |last9=Kinzler |first9=Kenneth W |last10=Vogelstein |first10=Bert |last11=de la Chapelle |first11=Albert |last12=Peltomäki |first12=Päivi }}</ref> No xenoma humano, as subfamilias activas máis recentemente foron as subfamilias do Elemento Transposón 6 AluS e 22 AluY debido á súa actividade herdada para causar varios cancros. Así, debido ao seu gran dano herdable é importante comprender as causas que afectan á súa actividade transcricional.<ref name=pmid29219079>{{citeCita journalpublicación periódica |doi=10.1186/s12864-017-4227-z |pmid=29219079 |pmc=5773891 |title=Computational identification of harmful mutation regions to the activity of transposable elements |journal=BMC Genomics |volume=18 |issue=Suppl 9 |pages=862 |year=2017 |last1=Jin |first1=Lingling |last2=McQuillan |first2=Ian |last3=Li |first3=Longhai }}</ref>
 
As seguintes enfermidades humanas foron ligadas con insercións ''Alu'':<ref name=pmid11988762/><ref name=pmid22204421>{{citeCita journalpublicación periódica |doi=10.1186/gb-2011-12-12-236 |pmid=22204421 |pmc=3334610 |title=Alu elements: Know the SINEs |journal=Genome Biology |volume=12 |issue=12 |pages=236 |year=2011 |last1=Deininger |first1=Prescott }}</ref>
* [[Síndrome de Alport]]
* [[Cancro de mama]]
* [[Diabetes mellitus]] tipo II
 
E as seguintes enfermidades foron asociadas con [[variación de ADN dun só nucleótido|variacións de ADN dun só nucleótido]] en elementos Alu que afectan a niveis de transcrición:<ref>{{citeCita web |url=http://www.snpedia.com/index.php/Rs2333227 |work=SNPedia |title=SNP in the promoter region of the myeloperoxidase MPO gene }}{{MEDRS|date=December 2017}}</ref>
* [[Enfermidade de Alzheimer]]
* [[Cancro de pulmón]]
=== Outras mutacións humanas asociadas a Alu ===
 
* O [[xene]] ''ACE'', que codifica o [[enzima convertedor da anxiotensina]], ten dúas variantes comúns, unha cunha inserción ''Alu'' (''ACE''-I) e outra cunha deleción ''Alu'' (''ACE''-D). Esta variación foi ligada a cambios na capacidade deportiva: a presenza do elemento ''Alu'' está asociada cun mellor rendemento en probas deportivas orientadas á resistencia física (por exemplo, [[tríatlon]]s), mentres que a súa ausencia está asociada co mellor rendemento en probas orientadas á forza (e potencia).<ref name=pmid21615186>{{citeCita journalpublicación periódica |doi=10.2165/11588720-000000000-00000 |pmid=21615186 |title=The ACE Gene and Human Performance |journal=Sports Medicine |volume=41 |issue=6 |pages=433–48 |year=2011 |last1=Puthucheary |first1=Zudin |last2=Skipworth |first2=James R.A |last3=Rawal |first3=Jai |last4=Loosemore |first4=Mike |last5=Van Someren |first5=Ken |last6=Montgomery |first6=Hugh E }}</ref>
* A [[duplicación xénica]] da [[opsina]], que [[evolución da visión das cores en primates|resultou]] na recuperación do [[tricromatismo]] en [[Catarrhini|primates do Vello Mundo]] (incluíndo os humanos) está flanqueada por un elemento ''Alu'',<ref name=pmid10413401>{{citeCita journalpublicación periódica |pmid=10413401 |url=http://genome.cshlp.org/cgi/pmidlookup?view=long&pmid=10413401 |year=1999 |author1=Dulai |first1=K. S |title=The evolution of trichromatic color vision by opsin gene duplication in New World and Old World primates |journal=Genome Research |volume=9 |issue=7 |pages=629–38 |last2=von Dornum |first2=M |last3=Mollon |first3=J. D |last4=Hunt |first4=D. M |doi=10.1101/gr.9.7.629|doi-broken-date=2019-02-17 }}</ref> o que implica o papel do ''Alu'' na evolución da [[visión das cores]].
 
== Notas ==
=== Ligazóns externas ===
* {{MeshName|Alu+Repetitive+Sequences}}
*{{citeCita journalpublicación periódica |url=https://www.ncbi.nlm.nih.gov/nuccore/NR_002715.1 |title=NCBI Genbank DNA encoding 7SL RNA |date=2018-05-12 }}
 
{{control de autoridades}}
393.002

edicións

Menú de navegación