Marco aberto de lectura

Na Galipedia, a Wikipedia en galego.
Esquema dun marco aberto de lectura, que inclúe o codón de inicio (ou start) e o de parada (ou stop).

En xenética chámase marco aberto de lectura, pauta aberta de lectura, marco de lectura aberto ou ORF (Open reading frame) a calquera secuencia de ADN comprendida entre un codón de inicio da tradución e un codón de terminación, que potencialmente podería servir para codificar unha proteína. Está limitado polas rexións non traducidas ou UTR (Untranslated Regions).

Descrición[editar | editar a fonte]

Os ORFs utilízanse para buscar xenes que codifican proteínas en secuencias de nucleótidos[1]. A procura de ORFs está facilitada polo uso de ferramentas bioinformáticas, que utilizan algoritmos que buscan os codóns de inicio ou parada. Cando se encontra un ORF é un bo indicio de que a secuencia pode ser un xene, do cal o ORF formará parte. O descubrimento dun codón de parada nunha secuencia non é por si só indicio de que hai alí un xene, xa que o codón de parada pode formarse por pura casualidade (nunha secuencia con igual cantidade de nucleótidos de cada clase é esperable que apareza un codón de parada de forma aleatoria unha vez cada 25 codóns). Os ORF que conteñen xenes son xeralmente longos, duns 300-400 codóns, o que é suficiente para o tamaño típico dunha proteína. Se son moi curtas non soen ser xenes. É máis doado atopalas en procariotas que en eucariotas, xa que estes últimos teñen intróns non codificantes intercalados entre os exóns, e neles é mellor estudar a secuencia do ARNm maduro.

Hai que buscar unha secuencia que empece nun codón de inicio e forme unha sucesión de codóns e acabe nun codón de parada. Pero como a secuencia hai que lela de tres en tres nucleótidos (para formar os codóns) podemos empezar tomando como primeiro nucleótido calquera. Segundo por cal empecemos poden formarse ou non ORFs con codóns de parada, xa que os codóns formados serán distintos.

Secuencia exemplo no que se mostran tres marcos de lectura. Os codóns de inicio están indicados en púrupura, e os de parada en vermello.

Nunha secuencia de ADN calquera, que é bicatenario, hai, a priori, 6 posibles sentidos nos que poden aparecer marcos abertos de lectura, tres lendo a secuencia nun sentido e tres no sentido da cadea complementaria. Dado que cada codón comprende 3 nucleótidos, existen 3 posibles lugares de inicio para empezar a coller os nucleótidos de 3 en 3 (e en caso de que se tomara o cuarto nucleótido como lugar de inicio, isto faría coincidir o marco aberto de lectura co mesmo que se formaría se se toma como inicio o primeiro nucleótido). A estes hai que engadir outros 3 posibles marcos abertos de lectura se o ADN é traducido tomando como molde a fibra complementaria, no sentido de lectura oposto. Estes marcos abertos de lectura denomínanse +1, +2, +3, -1, -2 e -3.

Neste exemplo con esta secuencia dunha cadea de ADN, podemos lela en sentido 5'→3' de 3 maneiras: empezando no primeiro triplete polo nucleótido a, polo t ou polo g, de modo que se orixinarán distintos codóns. Vanse formar codóns de inicio (atg) e de parada (taa, tga ou tag). A secuencia 1 empeza por un codón de inicio e acaba por un codón de parada e é a máis longa, polo que seguramente é o xene buscado. Na 2 e na 3 fórmanse varios codóns de parada polo que as secuencias son moi curtas, así que non son xenes.

5' atgcaaaacctgaatagtttagaggggttttcatcatttgaaaacgatttataa 3'
(1) atg caa aac ctg aat agt tta gag ggg ttt tca tca ttt gaa aac gat tta taa
(2) tgc aaa acc tga ata gtt tag agg ggt ttt cat cat ttg aaa acg att tat
(3) gca aaa cct gaa tag ttt aga ggg gtt ttc atc att tga aaa cga ttt


Cada un dos posibles marcos abertos de lectura daría lugar a unha secuencia proteica absolutamente diferente, pero non todos teñen que ser verdadeiros xenes.

Notas[editar | editar a fonte]

  1. Deonier, Richard; Simon Tavaré, Michael Waterman (2005). Computational Genome Analysis: an introduction. Springer-Verlag. p. 25. ISBN 0-387-98785-1.

Véxase tamén[editar | editar a fonte]

Outros artigos[editar | editar a fonte]

Ligazóns externas[editar | editar a fonte]